However, a tandem Pro was generated at the IgG mAb48 Vrecombination site, although a single Pro was present at the site of the mAb13 and mAb49 Vsegments. Thus, the anti-insulin IgG mAb H CDR3 and Vjunctional sequences contain elements that are thought to play a role in insulin-binding in both human IgM and mouse IgG anti-insulin autoantibodies. anti-insulin IgG mAb VH gene sequences, when compared with those of the closest reported germ-line genes, were concentrated in the CDR (6.2 Aprotinin 10C2 and 0.8 10C2 difference/base in CDR and FR, respectively; < 0.01, type b capsular polysaccharide (9), have suggested that the Ig V genes used by these antibodies extensively overlap with the pool of Ig V genes used by natural antibodies or autoantibodies and are expressed in the fetal and adult B cell repertoires. They also showed that some of these antibodies underwent a process of somatic hypermutation Aprotinin and Ag-driven clonal selection. Similar features seem to be displayed by human autoimmune disease-related autoantibodies, such as anti-DNA antibodies in SLE patients5 (10C12) and rheumatoid factors (RF)6 in rheumatoid arthritis patients (13C16). However, although these autoantibodies appear to be specific and display a high affinity for the relevant self Ag, they might be induced by unrelated cross-reacting, perhaps foreign, Ag. For instance, it has been suggested that at least some anti-DNA antibodies can be elicited by cross-reacting structures on bacteria (17). As emphasized by ICAM4 Thomas (18), the administration of recombinant human insulin for therapeutic purposes provides a unique opportunity for the structural analysis of specific autoantibodies actually induced by a self Ag, to which naturally occurring antibodies exist in the normal B cell repertoire (19, 20). In patients with insulin-dependent (type I) diabetes mellitus (IDDM), antiislet cell surface and anti-insulin receptor IgG autoantibodies are present in the circulating blood before the development of overt disease and possibly play a major immunopathologic role by destroying the insulin-producing -cells in the pancreas (reviewed in Ref. 21). Some circulating anti-insulin and antiproinsulin autoantibodies also exist in these patients before the development of overt disease (22C24). Their titer increases dramatically after administration with not only animal but also human insulin and they may complicate the therapeutic treatment (25). The structure of the VH segments of six anti-insulin IgM antibodies appearing after insulin treatment, has been recently reported (18, 26, 27). This, however, may not reflect the structure of the bulk Aprotinin of the specific high avidity anti-insulin autoantibodies, which are mainly IgG (28). We report the complete structure of the VH and Vsegments of three anti-insulin IgG mAb generated from IDDM patients treated with recombinant insulin. The three IgG mAb were specific and displayed relatively high affinity for human Aprotinin insulin. They used three distinct VH genes in combination with Vprimer sequence (5 TAGTCCTTGACCAGGCAGCC 3) was the reverse-complement of a 5 portion of the IgG C region gene conserved Aprotinin in all four human IgG subclasses (6, 31). The sense Voligonucleotide primers were synthesized and used to amplify the expressed Vgene cDNA (16). The degenerate Voligonucleotide primer sequence (5 CTGCTCATCAGATGGCGGGAAGA 3) was the reverse complement of a 5 sequence of the human Cgene (16). PCR was performed in a 50 DNA polymerase (Perkin Elmer Cetus, Norwalk, CT) for 25 cycles (1 min at 94C, 2 min at 55C, and 2 min at 72C). Amplified DNA was cloned into pCR1000 vector (Invitrogen, La Jolla, CA) and dideoxy sequencing was performed using plasmid dsDNA prepared from selected bacterial clones as reported (6). Each VH and VK gene sequence was determined by analyzing at least four independent clones isolated from an identical source. Intraclonal nucleotide variations were.